Transparencia Activa

Universidad de Santiago de Chile

Fecha de última actualización

20/11/2017

Otras Compras abril 2016

Tipo Denominación  Fecha  Nombre o razón social  Rut persona natural o Jurídica  Socios Accionistas Principales Objeto de la contratación Moneda Monto Total Inicio del contrato Término del contrato Documento Modificaciones
Pedido proveedor Servicio 01-04-2016 4229 MANANTIAL S.A. 0967115908 No aplica  Abastecimiento de agua purificada;
- Según Factura N°2705329
Pesos 9.519 01-04-2016 01-04-2016 PDF Sin modificaciones 
Pedido proveedor Servicio 01-04-2016 4230 MANANTIAL S.A. 0967115908 No aplica  Servicio de Abastecimeinto de Agua purificada;
- Según Factura N°2705253
Pesos 8.651 01-04-2016 01-04-2016 PDF Sin modificaciones 
Pedido proveedor Servicio 01-04-2016 4231 MANANTIAL S.A. 0967115908 No aplica  Servicio de Abastecimiento de agua purificada;
- Según Factura N°2691185
Pesos 8.651 01-04-2016 01-04-2016 PDF Sin modificaciones 
Pedido proveedor Servicio 01-04-2016 4232 BASH MONITOREO S.A 0967596906 No aplica  Servicio de repeción de señales de Alarma; Mes de Marzo/2016
- Según Factura N°519134
Pesos 30.609 01-04-2016 01-04-2016 PDF Sin modificaciones 
Pedido proveedor Servicio 04-04-2016 4233 Gabriel Ignacio Pailamilla Vergara 0101507912 No aplica  Mantencion y Reparacion de Aire acondicionado; 24000 BTU.
Sector: edificio CECTA - Laboratorio de Envase
- Según cotizacion adjunta.
Pesos 32.130 04-04-2016 04-04-2016 PDF Sin modificaciones 
Pedido proveedor Servicio 04-04-2016 4234 ASCENSORES SCHINDLER CHILE S.A. 0935650003 No aplica  Servicios de mantenimiento de Ascensor DIE;
Peridoo: Marzo - 2016
Valor UF: $ 25.759,73  x 3,2 UN
 - Según Factura N°71253184; Adjunta
Pesos 98.093 04-04-2016 04-04-2016 PDF Sin modificaciones 
Pedido proveedor Servicio 04-04-2016 4235 ASCENSORES SCHINDLER CHILE S.A. 0935650003 No aplica  Servicios de mantenimiento de ascensor DIE;
Periodo Febrero - 2016
Valor UF ( 10/02/2016 ): $ 25.633,50 x 3,2 UN
- Según Factura N° 71249003
Pesos 97.612 04-04-2016 04-04-2016 PDF Sin modificaciones 
Pedido proveedor Inscripción 05-04-2016 4236 MEETING POINT CONFERENCES ( EUROPE) LTD 0000000375 No aplica  Inscripción de José Luis Palacios a "17th European Congress of Biotechnology  ECB2016, a efectuarse en Cracovia, Polonia el 03-08-2016.-  Invoice N° ECB2016-017 Euro 495.01 05-04-2016 05-04-2016 PDF Sin modificaciones 
Pedido proveedor Insumo 05-04-2016 4237 IMPRENTA MINERVA LTDA. 085578100K No aplica  100 tarjetas de presentación;
Tamaño: 9 x 5,5 cm
Impresas a 2 Color relieve americano
Cartulina Opalina Extra Blanca
- Según cotización 0310/16 ; de Pia Leni
Pesos 35.462 05-04-2016 05-04-2016 PDF Sin modificaciones 
Pedido proveedor Servicio 05-04-2016 4238 EMPRESA DE CORREO DE CHILE 0605030009 No aplica  Servicio Envio de Correpondencia;
Según Factura N°150319
Pesos 1.462 05-04-2016 05-04-2016 PDF Sin modificaciones 
Pedido proveedor Concesión 05-04-2016 4239 PARQUE METROPOLITANO DE SANTIAGO 0618090000 No aplica  Servicio de Arriendo de Espacio de Mastil; Parque Metropolitano;
Periodo: Abril - 2016
Valor 25 UF: Valor UF ( 08/04/2016 ) $ 25.832,02
- Según Resolución N° 174
* C/Petición de Cheque.-
Pesos 645.801 01-04-2016 30-04-2016 PDF Sin modificaciones 
Pedido proveedor Insumo 06-04-2016 4240 CAPACITACION USACH CIA. LTDA. 0764213203 No aplica  Capacitación a empleados "Redacción y Ortografía", Sol. 16935, cc 32, RES 338. Pesos 225.000 06-04-2016 06-04-2016 PDF Sin modificaciones 
Pedido proveedor Suscripción 06-04-2016 4241 ALEJANDRO EGAS MUÑOZ 0073008824 No aplica  Electrodo E6013 3/32 1K BAUKER Pesos 60.690 06-04-2016 06-04-2016 PDF Sin modificaciones 
Pedido proveedor Servicio 06-04-2016 4242 EUROMONITOR INTERNATIONAL LTD 0000000142 No aplica  Passport : Renovación 2016,  27 categorias, 80 paises, Invoice N° 076201 Dólar americano 31,630.00 06-04-2016 06-04-2016 PDF Sin modificaciones 
Pedido proveedor Servicio 06-04-2016 4243 COMERCIAL M4 FITNESS LIMITADA 0763478629 No aplica  Servicios de mantención y reparación dos bicicletas estatias utilizadas en gimnasio kinesiologico.
- Modelo Bicicletas: Athletic 1800
- Según Cotización N° 2016-VAC577 ; Adjunta.
Pesos 68.782 06-04-2016 06-04-2016 PDF Sin modificaciones 
Pedido proveedor Servicio 06-04-2016 4243 COMERCIAL M4 FITNESS LIMITADA 0763478629 No aplica  Servicio de mantención y reparación equipo trotador utilizado en gimnasio kinesiologico.
Modelo Trotadora: Life Fitness
- Según Cotización N° 2016-VAC577 ; Adjunta.
Pesos 53.550 06-04-2016 06-04-2016 PDF Sin modificaciones 
Pedido proveedor Material 06-04-2016 4244 TELEVISION NACIONAL DE CHILE 0816898005 No aplica  Documental grandes Chilenos de nuestra Historia : Gabriela Mistral .-
Cotización
Pesos 47.600 06-04-2016 06-04-2016 PDF Sin modificaciones 
Pedido proveedor Insumo 06-04-2016 4245 ATEM INTEGRACIÓN TECNOLÓGICA LIMITADA 0760863181 No aplica  Teclado Apple Keyboard con teclado numerico español.
- Según Cotización N° JMC04041601
Pesos 50.774 06-04-2016 06-04-2016 PDF Sin modificaciones 
Pedido proveedor Bibliografía 06-04-2016 4246 BUSCALIBRE S.A 0760237132 No aplica  Ser Estratégico y Autónomo.../Monere0 Pesos 25.514 06-04-2016 06-04-2016 PDF Sin modificaciones 
Pedido proveedor Bibliografía 06-04-2016 4246 BUSCALIBRE S.A 0760237132 No aplica  El Aprendizaje Autonomo ../ Joan Pesos 17.550 06-04-2016 06-04-2016 PDF Sin modificaciones 
Pedido proveedor Suscripción 06-04-2016 4247 ARTE AL LIMITE LTDA 0761087118 No aplica  Revista Arte al Limite Renovación año 2016 a 6  ediciones del N° 77 al 82,  correo del 01-04-2016 Pesos 45.000 06-04-2016 06-04-2016 PDF Sin modificaciones 
Pedido proveedor Servicio 06-04-2016 4248 EMPRESA DE CORREO DE CHILE 0605030009 No aplica  Servicio de Envio de Correspondencia;
- Según Factura N° 178183
Pesos 80.639 06-04-2016 06-04-2016 PDF Sin modificaciones 
Pedido proveedor Servicio 07-04-2016 4250 JORGE ULICES GUTIERREZ TRANSPORTE PRIVAD 0098992030 No aplica  Servicio traslado pasajeros. Funcionario a cargo Sr.José Luis Llanos.SOLICITUD 18298.- Pesos 135.000 07-04-2016 07-04-2016 PDF Sin modificaciones 
Pedido proveedor Insumo 07-04-2016 4251 SIGMA SPACE CORPORATION 0000000374 No aplica  1 Equipo Detector LIDAR MiniMPL-532, Junto con, 1 MPL-WS , 1 MPL-CAM, 1 MPL-GIS: GPS; 1 MiniMPL-ENCL, 2 MPL-48-DET, according Quotation MPL-1601-2.0.2 del 31-03-2016 Dólar americano 121,905.67 07-04-2016 07-04-2016 PDF Sin modificaciones 
Pedido proveedor Insumo 07-04-2016 4252 ALEJANDRO EGAS MUÑOZ 0073008824 No aplica  CAJAS DE SEGURIDAD BASH MOD. M300A AT. SR.ALEJANDRO EGAS Pesos 34.986 07-04-2016 07-04-2016 PDF Sin modificaciones 
Pedido proveedor Servicio 08-04-2016 4253 RSA SEGUROS CHILE S.A. 0990170002 No aplica  Servicio de Póliza viaje específico.
Origen: Laboratorios de Calibración de la Universidad de Concepción.   
Destino: Laboratorio de Calibración del CIDE, ubicado en las Sophoras 175, Estación Central, Santiago.
 - Según Cotización adjunta.
Pesos 122.960 08-04-2016 08-04-2016 PDF Sin modificaciones 
Pedido proveedor Servicio 08-04-2016 4254 SERVICIO DE ADMINISTRACION DE RIESGOS LI 0771025102 No aplica  Servicio de Dosimetria Personal
- Proyecto 881-FB0807
- Según Cotización Adjunta.
Pesos 23.086 08-04-2016 08-04-2016 PDF Sin modificaciones 
Pedido proveedor Insumo 08-04-2016 4254 SERVICIO DE ADMINISTRACION DE RIESGOS LI 0771025102 No aplica  Portadosimetros ( Compra unica, Queda en propiedad del Comprador)
- Proyecto 881-FB0807
- Según Cotización Adjunta.
Pesos 11.900 08-04-2016 08-04-2016 PDF Sin modificaciones 
Pedido proveedor Aduana 11-04-2016 4255 AG ADUANA WALDEMAR ADELSDORFER Y CIA LTD 0777831100 No aplica  Desaduanamiento de kit de puntas AFM, provisión de fondos 233188 Pesos 620.581 11-04-2016 11-04-2016 PDF Sin modificaciones 
Pedido proveedor Servicio 11-04-2016 4256 Gabriel Ignacio Pailamilla Vergara 0101507912 No aplica  Servicio de Mantención y Reparación de Aire Acondicionado;
- Sector: Unidad de Adquisicón; Oficina N°3 ; Sección Compras.
- Según Cotización Adjunta.
Pesos 32.130 11-04-2016 11-04-2016 PDF Sin modificaciones 
Pedido proveedor Insumo 08-04-2016 4257 ATEM INTEGRACIÓN TECNOLÓGICA LIMITADA 0760863181 No aplica  Teclado Apple Keyboard con teclado numerico Español.
- Según Cotización N°JMC04041601
Pesos 50.774 08-04-2016 08-04-2016 PDF Sin modificaciones 
Pedido proveedor Suscripción 11-04-2016 4258 EDICIONES E IMPRESOS S.A. 0787446205 No aplica  Renovación anual Revista Capital, 24 ejemplares a partir del N° 418, con cotización Pesos 66.640 11-04-2016 11-04-2016 PDF Sin modificaciones 
Pedido proveedor Insumo 11-04-2016 4259 COMERCIAL MAUCO LTDA 0778799006 No aplica  Dispenser Desodorización Serie 3 C/Cinta.
- 6 UN Mensuales ( Marzo ; Abril y Mayo - 2016)
- Según Cotización N°X000100020058
Pesos 107.100 11-04-2016 11-04-2016 PDF Sin modificaciones 
Pedido proveedor Servicio 11-04-2016 4260 MANANTIAL S.A. 0967115908 No aplica  Servicio de Abastecimiento de Agua Purificada;
- Según Factura N°2647249
Pesos 27.275 11-04-2016 11-04-2016 PDF Sin modificaciones 
Pedido proveedor Servicio 11-04-2016 4261 SILVA SILVA VICTOR 0098220666 No aplica  Sandwiches y canapés con relle Pesos 46.410 11-04-2016 11-04-2016 PDF Sin modificaciones 
Pedido proveedor Servicio 11-04-2016 4261 SILVA SILVA VICTOR 0098220666 No aplica  Sandwiches y canapés con relle Pesos 46.410 11-04-2016 11-04-2016 PDF Sin modificaciones 
Pedido proveedor Materiales 11-04-2016 4263 ROUETTE EBER GMBH 0000000134 No aplica  Puertas 2 hojas  art. n° S805116R1,  ASS AT08604, Euro 3,647.44 11-04-2016 11-04-2016 PDF Sin modificaciones 
Pedido proveedor Materiales 11-04-2016 4263 ROUETTE EBER GMBH 0000000134 No aplica  Puerta 1 hoja, art. S805116R1,  ASS AT04304L Euro 273.27 11-04-2016 11-04-2016 PDF Sin modificaciones 
Pedido proveedor Materiales 11-04-2016 4263 ROUETTE EBER GMBH 0000000134 No aplica  Estantería Art. N° S05116R1, ASS OR04304 Euro 197.36 11-04-2016 11-04-2016 PDF Sin modificaciones 
Pedido proveedor Materiales 11-04-2016 4263 ROUETTE EBER GMBH 0000000134 No aplica  Estantantería con persianas  S805116R1, ASSQSU16204L  S7 Euro 459.92 11-04-2016 11-04-2016 PDF Sin modificaciones 
Pedido proveedor Materiales 11-04-2016 4263 ROUETTE EBER GMBH 0000000134 No aplica  Estante de Persiana  S805116R1, ASS QSU16204L S7 Euro 636.28 11-04-2016 11-04-2016 PDF Sin modificaciones 
Pedido proveedor Materiales 11-04-2016 4263 ROUETTE EBER GMBH 0000000134 No aplica  Mesas Tri Ass  S805116P3 STA1810 Euro 1,965.46 11-04-2016 11-04-2016 PDF Sin modificaciones 
Pedido proveedor Materiales 11-04-2016 4263 ROUETTE EBER GMBH 0000000134 No aplica  Tabla Dispositivo S805116R1, ASS STA1806 Euro 2,038.32 11-04-2016 11-04-2016 PDF Sin modificaciones 
Pedido proveedor Materiales 11-04-2016 4263 ROUETTE EBER GMBH 0000000134 No aplica  Mesón S80591R1  ASS STA2006 Euro 841.93 11-04-2016 11-04-2016 PDF Sin modificaciones 
Pedido proveedor Insumo 11-04-2016 4264 SOC. COM. DE PRODUCTOS INDUST. Y SERV LI 0764404904 No aplica  MS2108A  TENAZAS AMPERIMETRICA 400A AC/DC
1- PUNTAS DE PRUEBA
1- TERMOCUPLA K
1- MANUAL
1- ESTUCHE DE TRANSPORTE
-  Según Cotización N° 14889/15
Pesos 59.488 11-04-2016 11-04-2016 PDF Sin modificaciones 
Pedido proveedor Servicio 12-04-2016 4265 ELISE JUSTINE LIZAMA VANDROMME 0189094922 No aplica  Servicio de Coffee break para 15 personas en la Facultad de Ingeniería, reunión firma de convenio colaboración mutua entre usach y cisco Systems Chile S.A. Pesos 112.455 12-04-2016 12-04-2016 PDF Sin modificaciones 
Pedido proveedor Aduana 12-04-2016 4266 DHL EXPRESS (CHILE) LTDA 0869661007 No aplica  Desaduanamiento de repuestos de controladores , Factura Electrónica 406219 Pesos 241.931 12-04-2016 12-04-2016 PDF Sin modificaciones 
Pedido proveedor Insumo 12-04-2016 4267 LIBRERIA VIRTUAL Y DISTRIB EL ATICO LTDA 0760829080 No aplica  DVD documental Gabriela Mistral del Elqui al Mundo Pesos 8.925 12-04-2016 12-04-2016 PDF Sin modificaciones 
Pedido proveedor Insumo 12-04-2016 4267 LIBRERIA VIRTUAL Y DISTRIB EL ATICO LTDA 0760829080 No aplica  DVD Locas Mujeres Pesos 14.280 12-04-2016 12-04-2016 PDF Sin modificaciones 
Pedido proveedor Servicio 12-04-2016 4268 Gabriel Ignacio Pailamilla Vergara 0101507912 No aplica  Servicio de Mantención y reparación de Aire acondicionado Tipo Split;
Sector: Sala CAI, Sala N°676
- Según Cotización Adjunta.
Pesos 32.130 12-04-2016 12-04-2016 PDF Sin modificaciones 
Pedido proveedor Insumo 13-04-2016 4269 SODIMAC S.A. 096792430K No aplica  Lampara Tablero Dibujo con lupa color negra, Según linea 3 de la solicitud 17146,  cc 40. Pesos 27.980 13-04-2016 13-04-2016 PDF Sin modificaciones 
Pedido proveedor Inscripción 13-04-2016 4270 ORGIT S.R.O 0000000377 No aplica  Inscripción a congreso CHISA 2016.- participante Esteban Quijada Maldonado rut 13.931.685-1.- Euro 640.00 13-04-2016 13-04-2016 PDF Sin modificaciones 
Pedido proveedor Bibliografía 13-04-2016 4271 JORGE ULICES GUTIERREZ TRANSPORTE PRIVAD 0098992030 No aplica  Servicio traslado alumnos -.Solicitud 18457. Salida 14 abril 2016. a Localidad de Coltauco. Pesos 135.000 13-04-2016 13-04-2016 PDF Sin modificaciones 
Pedido proveedor Insumo 13-04-2016 4272 MACROGEN 0000000061 No aplica  Secuenciación de Plasmidos  Invoice N°ISC150907414-1 Dólar americano 1,715.00 13-04-2016 13-04-2016 PDF Sin modificaciones 
Pedido proveedor Insumo 13-04-2016 4274 EMARIN SDA S.A 0761626582 No aplica  50 multidiscos gram (+) Pesos 29.750 13-04-2016 13-04-2016 PDF Sin modificaciones 
Pedido proveedor Servicio 13-04-2016 4274 EMARIN SDA S.A 0761626582 No aplica  50 multidiscos gram (-) Pesos 29.750 13-04-2016 13-04-2016 PDF Sin modificaciones 
Pedido proveedor Insumo 14-04-2016 4275 SOC. COM. MIHOVILOVIC HNOS Y OTRO LTDA 0776470104 No aplica  Medio L15 Leibovitz, envase de 500 mL. Pesos 19.817 14-04-2016 14-04-2016 PDF Sin modificaciones 
Pedido proveedor Insumo 14-04-2016 4276 CALVI SYSTEMS,S.L. 0000000006 No aplica  Licencia anuales de ExxpertApps
Periodo de (01/01/.2015) - (31/07/2015)
N° Cliente: CL00104
N° Factura 2015K00173
- Según Resolución N° 454
Dólar americano 4,666.67 01-01-2015 31-07-2015 PDF Sin modificaciones 
Pedido proveedor Servicio 14-04-2016 4277 COMERCIAL MAUCO LTDA 0778799006 No aplica  Servicio de Higiene y ventilación industrial; Prohygiene
- Según Factura N°22851
Pesos 29.750 14-04-2016 14-04-2016 PDF Sin modificaciones 
Pedido proveedor materiales 14-04-2016 4278 ALEJANDRO EGAS MUÑOZ 0073008824 No aplica  Diferencial Tetrapolar de 4x25 A 30mA
- Según Cotización N°54/2016 ; adjunta
Pesos 91.035 14-04-2016 14-04-2016 PDF Sin modificaciones 
Pedido proveedor Insumo 15-04-2016 4279 ATEM INTEGRACIÓN TECNOLÓGICA LIMITADA 0760863181 No aplica  Splitter Audio Behringer M882 8 Canales;
-Según Cotización N° JMC12041601
Pesos 120.000 15-04-2016 15-04-2016 PDF Sin modificaciones 
Pedido proveedor Servicio 15-04-2016 4280 MANANTIAL S.A. 0967115908 No aplica  Servicio de Abastecimiento de Agua Purificada
- Según Factura N°2705254
Pesos 5.831 15-04-2016 15-04-2016 PDF Sin modificaciones 
Pedido proveedor materiales 15-04-2016 4281 ALEJANDRO EGAS MUÑOZ 0073008824 No aplica  Caja plastica 25 Litros con Tapa Apilable;
Según Cotización N° 55/2016.
Pesos 26.656 15-04-2016 15-04-2016 PDF Sin modificaciones 
Pedido proveedor Suscripción 19-04-2016 4282 EDITORIAL TELEVISA CHILE S.A. 0935850002 No aplica  Revista muy Interesante renovación anual  16 ediciones Pesos 24.565 19-04-2016 19-04-2016 PDF Sin modificaciones 
Pedido proveedor Suscripción 19-04-2016 4282 EDITORIAL TELEVISA CHILE S.A. 0935850002 No aplica  Revista National Geographic, renovación anual, 12 ediciones Pesos 22.015 19-04-2016 19-04-2016 PDF Sin modificaciones 
Pedido proveedor Suscripción 19-04-2016 4282 EDITORIAL TELEVISA CHILE S.A. 0935850002 No aplica  Revista Condorito Grandes Clásicos, renovación anual ,26 ediciones Pesos 30.515 19-04-2016 19-04-2016 PDF Sin modificaciones 
Pedido proveedor Insumo 19-04-2016 4283 SHENYANG TIANXING TESTING INSTRUMENTS CO 0000000381 No aplica  Magnetic Digital Brinell and Rockwell Hardness Tester Model PHBR-200 (Durometró ) Proforma Invoice N° 20151125IJ-7 Dólar americano 4,265.00 19-04-2016 19-04-2016 PDF Sin modificaciones 
Pedido proveedor Insumo 19-04-2016 4284 DIMERC S.A 0966708409 No aplica  Pizarra Blanca Mural 100x100  M/Aluminio Arcovi Pesos 58.641 19-04-2016 19-04-2016 PDF Sin modificaciones 
Pedido proveedor Insumo 19-04-2016 4284 DIMERC S.A 0966708409 No aplica  Revistero Malla Metal 3 comp /negro Pesos 17.850 19-04-2016 19-04-2016 PDF Sin modificaciones 
Pedido proveedor Insumo 19-04-2016 4284 DIMERC S.A 0966708409 No aplica  Set de Escritorio 5 piezas simil cuero  burdeo Saddler
Cotización DIMERC N° 6082616
Solicitud 17919 - Cc 83 Fac Cs Médicas
Despachar: MATUCANA 28-D, EST. CENTRAL
Contacto: Cecilia Contreras, fono: 227183532.
Pesos 31.197 19-04-2016 19-04-2016 PDF Sin modificaciones 
Pedido proveedor Insumo 19-04-2016 4285 CIMEL ELECTRONIQUE 0000000383 No aplica  Automatic Sunstracking Photometer CE318TS9- TRIPLE MODE:SUN, SKY, LUNAR,  ref: PH3183TRIPLE,    according  Proforma Invoice N° 160129.- Euro 38,357.10 19-04-2016 19-04-2016 PDF Sin modificaciones 
Pedido proveedor Servicio 20-04-2016 4286 HOTEL CONTE VERDE LIMITADA 0777051709 No aplica  Arriendo Generador de Electricidad para Catering
* Fecha de Arriendo: 26 de Abril / 2016
- Según Cotización N°108 Adjunta.
Pesos 47.481 20-04-2016 20-04-2016 PDF Sin modificaciones 
Pedido proveedor Servicio 20-04-2016 4287 UNIVERSIDAD  DEL PACIFICO 0000000384 No aplica  Inscripción Taller  Prodem código 11OINC-9569, Boleta N°B100-0001535 Dólar americano 600.00 20-04-2016 20-04-2016 PDF Sin modificaciones 
Pedido proveedor Servicio 21-04-2016 4288 JORGE ULICES GUTIERREZ TRANSPORTE PRIVAD 0098992030 No aplica  Servicio traslado alumnos. Solicitud 18586 a cargo prof. Sr. José Luis Llanos. Pesos 135.000 21-04-2016 21-04-2016 PDF Sin modificaciones 
Pedido proveedor Servicio 21-04-2016 4289 INST.BRITANICO DE CULTURA CAPAC.S.A. 0764854209 No aplica  Capacitación; Inglés Comunicativo Pre-Intermedio;Carlos Godoy -1.Solicitud 15601 Pesos 82.500 21-04-2016 21-04-2016 PDF Sin modificaciones 
Pedido proveedor Servicio 21-04-2016 4290 CONSULTORA EDUC. Y DE CAPAC. S.A. 0968220306 No aplica  Técnicas de gestión de comités paritarios, Factura N° 130. Pesos 200.000 21-04-2016 21-04-2016 PDF Sin modificaciones 
Pedido proveedor Suscripción 21-04-2016 4291 CORPORACION CINCEL 0655216502 No aplica  Knovel Suscripción a Base de Datos de e-books 2015-2016,   Invoice M258344, Resolución 1593 del 19-04-2016 Dólar americano 24,765.00 21-04-2016 21-04-2016 PDF Sin modificaciones 
Pedido proveedor Servicio 21-04-2016 4292 PABLO CARO DE KARTZOW CAPACITACIONES 0765394600 No aplica  Aplicaciones de técnicas y estrategias para el audocuidado. Factura N° 919. Pesos 16.000 21-04-2016 21-04-2016 PDF Sin modificaciones 
Pedido proveedor Suscripción 21-04-2016 4293 CORPORACION CINCEL 0655216502 No aplica  Renovación IOP Consorciada a través de Cincel  periodo 13-11-2015 al 13-11-2016, Resolución 1589 del 19-04-2016, Proforma N° 1474 Pesos 15.160 13-11-2015 13-11-2016 PDF Sin modificaciones 
Pedido proveedor Servicio 21-04-2016 4294 MACMILLAN PUBLISHERS LTD 0000000385 No aplica  Publicación de Articulo "The Solar Spectrum in the Atacama
Desert"  en Revista Internacional , Invoice N° 198324OI
Dólar americano 1,495.00 21-04-2016 21-04-2016 PDF Sin modificaciones 
Pedido proveedor Renovación 22-04-2016 4295 ITMS GROUP, INC 0000000299 No aplica  Renovación Base de Datos referencial  CREDO,  periodo 02-06-2016 al 01-06-2017, Invoice N° 11122 Dólar americano 14,842.00 22-04-2016 22-04-2016 PDF Sin modificaciones 
Pedido proveedor Bibliografía 25-04-2016 4296 PONTIFICIA UNIVERSIDAD CATOLICA DE CHILE 0816989000 No aplica  Inscripción Individual al 1° Congreso Internacional "La innovación construye inclus. Nuevas propuestas sobre acceso Universal".
Inscripcion al alumno: David Almonte Arcos
Rut: 18.858.498-3
- Según Cotización Adjunta.-
Pesos 35.000 25-04-2016 25-04-2016 PDF Sin modificaciones 
Pedido proveedor Insumo 25-04-2016 4297 ATEM INTEGRACIÓN TECNOLÓGICA LIMITADA 0760863181 No aplica  Tinta Medium Blue RZ-EZ-MZ RISO Original
Cotización ATEM N° JMC25041601
Solicitud 16958 - Cc 50 Fac de Ciencia
Despacho de mercadería  y factura en Avda.              
El Belloto 3580, Almacén General,  Est. Central.
Pesos 74.299 25-04-2016 25-04-2016 PDF Sin modificaciones 
Pedido proveedor Servicio 25-04-2016 4298 VERONICA PAZ GONZALEZ ALVAREZ 0116308789 No aplica  Servicio de Coffee  Charla "Igualdad y no Discriminación" Pesos 100.841 25-04-2016 25-04-2016 PDF Sin modificaciones 
Pedido proveedor Servicio 25-04-2016 4299 CAPACITACION USACH CIA. LTDA. 0764213203 No aplica  Curso "Análisis y Tratamiento de Datos con el Software Estadístico SPSS", Resolución 1609 del 19/04/2016. Pesos 81.600 25-04-2016 25-04-2016 PDF Sin modificaciones 
Pedido proveedor Servicio 25-04-2016 4300 EMPRESA SOCIAL DE COMERC. DE PRODUCTOS 0760268283 No aplica  Servicio de Abastecimiento de Agua Purificada;
- Según Factura N°31153
Pesos 23.134 25-04-2016 25-04-2016 PDF Sin modificaciones 
Pedido proveedor Servicio 25-04-2016 4301 EMPRESA SOCIAL DE COMERC. DE PRODUCTOS 0760268283 No aplica  Servicio de Abastecimiento de Agua Purificada.
- Según Factura N°31154
Pesos 26.168 25-04-2016 25-04-2016 PDF Sin modificaciones 
Pedido proveedor Servicio 26-04-2016 4302 JORGE ULICES GUTIERREZ TRANSPORTE PRIVAD 0098992030 No aplica  Servicios de Transporte - Alumnos Agronegocios
Cotización 25/04/2016
Fecha salida: jueves 28 abril 2016
Sal. Fac Tecnológica - Loc. Coltauco
Salida: 08:00 hrs  - Regreso 18:00 hrs
Cantidad de Personas: 8 alumnos
Pesos 135.000 26-04-2016 26-04-2016 PDF Sin modificaciones 
Pedido proveedor Insumo 26-04-2016 4303 SCHRODINGER,LLC 0000000136 No aplica  Compra de Licencia de Software, Jaguar Floating License, periodo 01-05-2016 al 30-04-2019, Quotation 16406 Dólar americano 2,700.00 26-04-2016 26-04-2016 PDF Sin modificaciones 
Pedido proveedor Insumo 26-04-2016 4304 ARTESANIA DESMADRYL LTDA. 0797578908 No aplica  Galvano Impresión láser; Cod. 8621
- Según Cotización Adjunta.
Pesos 25.942 26-04-2016 26-04-2016 PDF Sin modificaciones 
Pedido proveedor Insumo 26-04-2016 4305 RHONA S.A 0923070001 No aplica  Tapa Flexible Ble Blanca - Ancho 85 MM; cod. 261623
- Según cotización N°600377
Pesos 61.130 26-04-2016 26-04-2016 PDF Sin modificaciones 
Pedido proveedor Insumo 26-04-2016 4306 IMPRENTA MINERVA LTDA. 085578100K No aplica  Provincias Vicerrectoría Academica
Tamaño; 28 x 10,05 cms
Impresa a 1 Color; Offset
Papel Autocopiativo Blanco-amarillo
5 Blocks
Según Cotización N°0411/16
Pesos 117.810 26-04-2016 26-04-2016 PDF Sin modificaciones 
Pedido proveedor Inscripción 27-04-2016 4307 IVOMAT ARGENTINA S.A 0000000386 No aplica  Inscripción a IX Cumbre Mundial de Comunicación Política .- participante Alicia Vargas Muñoz  C.I. 8.834.190-6,   Factura N° 00000006, del 26-04-2016 Dólar americano 349.00 27-04-2016 27-04-2016 PDF Sin modificaciones 
Pedido proveedor Servicio 28-04-2016 4308 BUHODRA INGENIERIA S.A 0000000387 No aplica  25 Licencias de uso Educacionales aplicación  informática Istram: :Diferentes Modulos + Servicios de mantenimiento, actualizaciones y asistencia  Técnica para  los Modulos adquiridos periodo 01-05-16 al 30-04-17 .-   Según Factura N° FA160321 Euro 3,870.00 28-04-2016 28-04-2016 PDF Sin modificaciones 
Pedido proveedor Servicio 28-04-2016 4309 MANANTIAL S.A. 0967115908 No aplica  Servicio de Abastecimiento de Agua Purificada;
Según Factura N°2705155
Pesos 9.782 28-04-2016 28-04-2016 PDF Sin modificaciones 
Pedido proveedor Servicio 28-04-2016 4310 MANANTIAL S.A. 0967115908 No aplica  Servicio de Abastecimiento de agua Purificada;
- Según Factura N° 2735485
Pesos 41.983 28-04-2016 28-04-2016 PDF Sin modificaciones 
Pedido proveedor Servicio 28-04-2016 4311 COLOR IMPRESORES LIMITADA 0775720301 No aplica  Servicio de Muestras de color + Traslado
- Según Factura N°0030734
Pesos 15.470 28-04-2016 28-04-2016 PDF Sin modificaciones 
Pedido proveedor Servicio 28-04-2016 4311 COLOR IMPRESORES LIMITADA 0775720301 No aplica  Servicio de Prueba de color + Traslado
- Según Factura N°0030741
Pesos 33.320 28-04-2016 28-04-2016 PDF Sin modificaciones 
Pedido proveedor Servicio 28-04-2016 4312 CAPACITACION USACH CIA. LTDA. 0764213203 No aplica  Curso-Tecnico practico para la plataforma de aprendizaje moodle Pesos 86.400 28-04-2016 28-04-2016 PDF Sin modificaciones 
Pedido proveedor Servicio 28-04-2016 4314 CAPACITACION USACH CIA. LTDA. 0764213203 No aplica  curso Didactica en laEnseñanza Universitaria, Resol 1609 del 19/04/2016 Pesos 812.000 28-04-2016 28-04-2016 PDF Sin modificaciones 
Pedido proveedor Inscripción 28-04-2016 4315 S.C.CERCETARE DEZVOLTARE AGORA S.R.L 0000000388 No aplica  Inscripción de Paper McEliece¿s Public Key Crypstosystem based on Non-Binary Algebraic Codes . Autores Hugo Rodriguez , y otros, Invoice N° 48/26.04.2016 Euro 800.00 28-04-2016 28-04-2016 PDF Sin modificaciones 
Pedido proveedor Servicio 28-04-2016 4316 QUALITAS S.A. 0760172677 No aplica  Proceso de Acreditación; Carrera Licenciatura en Historia;
Valor: 129,5 UF; Cuota N° 2 / 4
- Según Res. 6195 // Factura N°1137
Pesos 2.927.316 28-04-2016 28-04-2016 PDF Sin modificaciones 
Pedido proveedor Servicio 28-04-2016 4316 QUALITAS S.A. 0760172677 No aplica  Proceso de Acreditación; Carrera Licenciatura en Historia;
Valor: 129,5 UF; Cuota N° 3 / 4
- Según Res. 6195 // Factura N°1138
Pesos 2.927.316 28-04-2016 28-04-2016 PDF Sin modificaciones 
Pedido proveedor Servicio 29-04-2016 4317 DENHAM Y MOYANO CAPACITACION LTDA 0762516926 No aplica  Técnicas de comunicación en equipos de trabajo. Factura N° 22. Pesos 559.930 29-04-2016 29-04-2016 PDF Sin modificaciones 
Pedido proveedor Servicio 29-04-2016 4318 FERMELO S.A. 0784364305 No aplica  Sintesis Pligonucletidos 25nmoles;
Primer IFN: CCGTACACCGATTGAGGACT
- Según Cotización N°27567
Pesos 7.319 29-04-2016 29-04-2016 PDF Sin modificaciones 
Pedido proveedor Servicio 29-04-2016 4318 FERMELO S.A. 0784364305 No aplica  Sintesis Pligonucletidos 25nmoles;
Primer IFN: GCGGCATTACTCCATCCTAA
- Según Cotización N°27567
Pesos 7.319 29-04-2016 29-04-2016 PDF Sin modificaciones 
Pedido proveedor Servicio 29-04-2016 4319 DENHAM Y MOYANO CAPACITACION LTDA 0762516926 No aplica  Tecnicas en computación en equipos de trabajo, Factura N° 21. Solicitud N° 15700. Pesos 274.930 29-04-2016 29-04-2016 PDF Sin modificaciones 
Pedido proveedor Servicio 29-04-2016 4320 COMERCIALIZADORA MD TECNOLOGIA LTDA 0764690893 No aplica  D-Link Printe Server 10/100 + USB 2.0 IPP
- Según Cotización Adjunta.-
Dólar americano 76.16 29-04-2016 29-04-2016 PDF Sin modificaciones 
Pedido proveedor Servicio 29-04-2016 4321 DARTMOUTH JOURNAL SERVICES 0000000390 No aplica  Publicación de Artículo Isolation and Characterization of Salmonid CD4+ T Cells.- en American of Inmunologist -The Journal of Inmunology , Invoice JI-28377-0 Dólar americano 4,560.00 29-04-2016 29-04-2016 PDF Sin modificaciones 
Pedido proveedor Servicio 29-04-2016 4322 COLUMBIA INTERNATIONAL TECHNICAL EQUIPME 0000000389 No aplica  Hig-Pressure Chemical Reactor (Model: CIT-HIPR-SF5L) Accordint Proforma Invoice N° CIT-2016-16058R4 dated 02-05-2016 Dólar americano 17,295.00 29-04-2016 29-04-2016 PDF Sin modificaciones 
Pedido proveedor Servicio 29-04-2016 4323 ASCENSORES SCHINDLER CHILE S.A. 0935650003 No aplica  Servicios de mantenimiento de Ascensor mes de Abril / 2016.
- Según Factura N° 71257726
Pesos 98.403 29-04-2016 29-04-2016 PDF Sin modificaciones 
Pedido proveedor Servicio 29-04-2016 4324 MANANTIAL S.A. 0967115908 No aplica  Servicio de Abastecimiento de Agua Purificada;
- Según Factura N°2706909
Pesos 27.275 29-04-2016 29-04-2016 PDF Sin modificaciones